ID: 1131894013_1131894018

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1131894013 1131894018
Species Human (GRCh38) Human (GRCh38)
Location 15:97006377-97006399 15:97006407-97006429
Sequence CCCTACGTAGATGATGGTCTTTC GTTAGGAGAAAAAGTGAACTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!