ID: 1131909579_1131909584

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1131909579 1131909584
Species Human (GRCh38) Human (GRCh38)
Location 15:97182742-97182764 15:97182773-97182795
Sequence CCCATGGAATCCTGCCATCGCTG CATATAACACACCGAGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 90} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!