ID: 1131912560_1131912574

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1131912560 1131912574
Species Human (GRCh38) Human (GRCh38)
Location 15:97224278-97224300 15:97224326-97224348
Sequence CCGGCGCTGGCGGGCCAGCGCGA GGCCCCGCACTTGGAGCCGCTGG
Strand - +
Off-target summary No data {0: 5, 1: 46, 2: 359, 3: 520, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!