ID: 1131915254_1131915261

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1131915254 1131915261
Species Human (GRCh38) Human (GRCh38)
Location 15:97258087-97258109 15:97258126-97258148
Sequence CCACAGAGATTTTGTGTCCAGAG GCAGCACTACTAGTGGGTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!