ID: 1131962585_1131962592

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1131962585 1131962592
Species Human (GRCh38) Human (GRCh38)
Location 15:97805148-97805170 15:97805177-97805199
Sequence CCTCTCTGGAAACAAGGACATAC TGGCTGCCTGGTTGTAAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 175} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!