ID: 1132061143_1132061146

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1132061143 1132061146
Species Human (GRCh38) Human (GRCh38)
Location 15:98693302-98693324 15:98693317-98693339
Sequence CCATGTAGAGGGGCAAGATTTAC AGATTTACCACCCTGTTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73} {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!