ID: 1132069055_1132069063

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1132069055 1132069063
Species Human (GRCh38) Human (GRCh38)
Location 15:98759464-98759486 15:98759479-98759501
Sequence CCTTCCCCTGCATTACAGAAGAA CAGAAGAACGGCCCCCCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 225} {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!