ID: 1132083577_1132083586

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1132083577 1132083586
Species Human (GRCh38) Human (GRCh38)
Location 15:98887818-98887840 15:98887862-98887884
Sequence CCTACCCTCTCTGATCATCATGT ACCTTTCTGATACGAAGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 234} {0: 1, 1: 0, 2: 0, 3: 4, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!