ID: 1132132581_1132132583

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1132132581 1132132583
Species Human (GRCh38) Human (GRCh38)
Location 15:99296592-99296614 15:99296627-99296649
Sequence CCAGGCTGTATATGTGTGGTCAG ATAGATTTTCTCTATTTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108} {0: 1, 1: 0, 2: 5, 3: 59, 4: 792}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!