ID: 1132179017_1132179021

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1132179017 1132179021
Species Human (GRCh38) Human (GRCh38)
Location 15:99737623-99737645 15:99737656-99737678
Sequence CCTCTCTGCTGCCTGGAATAAAG CAGAGCACATGCAGTCATCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!