ID: 1132184572_1132184577

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1132184572 1132184577
Species Human (GRCh38) Human (GRCh38)
Location 15:99792178-99792200 15:99792198-99792220
Sequence CCATTATTTTGGCTCCAGAGTGG TGGCCTTATGGACCTCCTGGAGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 1, 3: 13, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!