ID: 1132214911_1132214918

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1132214911 1132214918
Species Human (GRCh38) Human (GRCh38)
Location 15:100055354-100055376 15:100055401-100055423
Sequence CCAGGCTGGAGCAGGCCACAAGC TGGCCTCAGTTCTTGTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 227} {0: 1, 1: 0, 2: 0, 3: 19, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!