ID: 1132223479_1132223492

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1132223479 1132223492
Species Human (GRCh38) Human (GRCh38)
Location 15:100123075-100123097 15:100123115-100123137
Sequence CCCAACTTTCCCAAGGACCCCAC AAGCCTGAACTGTGTGGACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 171} {0: 1, 1: 0, 2: 1, 3: 9, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!