ID: 1132236713_1132236718

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1132236713 1132236718
Species Human (GRCh38) Human (GRCh38)
Location 15:100227562-100227584 15:100227600-100227622
Sequence CCCAGTGATGGCACATCGCTGGA TCCTCCTGGCCTTTCCCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77} {0: 1, 1: 1, 2: 7, 3: 56, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!