ID: 1132273349_1132273356

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1132273349 1132273356
Species Human (GRCh38) Human (GRCh38)
Location 15:100544984-100545006 15:100545014-100545036
Sequence CCTCTTCAGAAGGTGAAAACACG TACAGGCTGTTGATAGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!