ID: 1132311095_1132311101

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1132311095 1132311101
Species Human (GRCh38) Human (GRCh38)
Location 15:100858545-100858567 15:100858583-100858605
Sequence CCCTGAGGGTCCCAGAAGGGAGC TCTCACTAGGCCAGAATTCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!