ID: 1132329282_1132329292

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1132329282 1132329292
Species Human (GRCh38) Human (GRCh38)
Location 15:101000517-101000539 15:101000562-101000584
Sequence CCTGGAGGTCAGCAGTCCACGGT TCTCCTGGAAGCCCTGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 157} {0: 1, 1: 1, 2: 4, 3: 54, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!