ID: 1132329856_1132329870

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1132329856 1132329870
Species Human (GRCh38) Human (GRCh38)
Location 15:101004735-101004757 15:101004768-101004790
Sequence CCCTGCTCCTTCTGCAGTTCAGG CAGCTCAGGGGATGTGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 297} {0: 1, 1: 3, 2: 4, 3: 44, 4: 505}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!