ID: 1132329856_1132329873

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1132329856 1132329873
Species Human (GRCh38) Human (GRCh38)
Location 15:101004735-101004757 15:101004782-101004804
Sequence CCCTGCTCCTTCTGCAGTTCAGG TGGAGGAGGTGCTGAGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 297} {0: 1, 1: 2, 2: 8, 3: 101, 4: 1170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!