ID: 1132330695_1132330700

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1132330695 1132330700
Species Human (GRCh38) Human (GRCh38)
Location 15:101010428-101010450 15:101010478-101010500
Sequence CCTTCCTTCTTCTCCATCGCAGG AAGTTGTCCCACCTCCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 28, 4: 283} {0: 1, 1: 0, 2: 4, 3: 16, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!