ID: 1132359396_1132359402

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1132359396 1132359402
Species Human (GRCh38) Human (GRCh38)
Location 15:101200317-101200339 15:101200369-101200391
Sequence CCTACTGCATTTCACATGACGGG GAGCCTGGCCTGCTTCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 70} {0: 1, 1: 0, 2: 7, 3: 30, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!