ID: 1132359661_1132359667

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1132359661 1132359667
Species Human (GRCh38) Human (GRCh38)
Location 15:101201819-101201841 15:101201862-101201884
Sequence CCTTTCCTGAACTGTGTTCAAAG TGTTCTCCCAGTAGGTGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 194} {0: 1, 1: 0, 2: 2, 3: 11, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!