ID: 1132365117_1132365126

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1132365117 1132365126
Species Human (GRCh38) Human (GRCh38)
Location 15:101251541-101251563 15:101251565-101251587
Sequence CCCTAGCGCCGCGAGGCCCGGCC GGGCAGCGCCGCCGCCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84} {0: 2, 1: 0, 2: 13, 3: 69, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!