ID: 1132376297_1132376303

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1132376297 1132376303
Species Human (GRCh38) Human (GRCh38)
Location 15:101330302-101330324 15:101330349-101330371
Sequence CCTCGCTCACTTCCTCTATTTCT AGTCCAGGTGCAGCCTCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 83, 4: 1129} {0: 1, 1: 0, 2: 0, 3: 20, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!