ID: 1132376877_1132376884

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1132376877 1132376884
Species Human (GRCh38) Human (GRCh38)
Location 15:101334015-101334037 15:101334059-101334081
Sequence CCGGAAGAGGTAAGCAAGGCCCT AGCATAGCATTTCTAGCACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167} {0: 1, 1: 0, 2: 1, 3: 12, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!