ID: 1132411487_1132411489

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1132411487 1132411489
Species Human (GRCh38) Human (GRCh38)
Location 15:101581465-101581487 15:101581515-101581537
Sequence CCTGTCATGGTCTAGGAGTGTTC CTTGATGTGCATGATTTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65} {0: 1, 1: 9, 2: 10, 3: 27, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!