ID: 1132413078_1132413086

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1132413078 1132413086
Species Human (GRCh38) Human (GRCh38)
Location 15:101600205-101600227 15:101600219-101600241
Sequence CCACGTGGCCTCTGCTGACACTG CTGACACTGCAGGTGGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 49, 4: 347} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!