|
Left Crispr |
Right Crispr |
| Crispr ID |
1132416576 |
1132416581 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:101624530-101624552
|
15:101624577-101624599
|
| Sequence |
CCATAATGTTTTAGGAAAGTTTA |
AAGCCATCCTGGCCCTCATGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 19, 2: 36, 3: 77, 4: 331} |
{0: 1, 1: 9, 2: 108, 3: 262, 4: 808} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|