ID: 1132422543_1132422548

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1132422543 1132422548
Species Human (GRCh38) Human (GRCh38)
Location 15:101684782-101684804 15:101684812-101684834
Sequence CCTGCAGAAAGCACTCCTAGCTT CCATTGCCTCTAAGCCACCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 137} {0: 1, 1: 0, 2: 1, 3: 7, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!