ID: 1132432466_1132432473

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1132432466 1132432473
Species Human (GRCh38) Human (GRCh38)
Location 15:101772762-101772784 15:101772814-101772836
Sequence CCAGCGGAGTTGAAAAATGCAAC AGGCATACACAGAACAAACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 29, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!