ID: 1132448475_1132448478

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1132448475 1132448478
Species Human (GRCh38) Human (GRCh38)
Location 15:101951341-101951363 15:101951390-101951412
Sequence CCAGTGATCTTATACAATATGAT CTCCTTCATAAGCAAGCCACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!