ID: 1132455039_1132455050

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1132455039 1132455050
Species Human (GRCh38) Human (GRCh38)
Location 16:17595-17617 16:17634-17656
Sequence CCAGCAGACTTGCAGGGCCCGCT CTTGCTCTGGATCCTGTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 0, 3: 8, 4: 123} {0: 7, 1: 1, 2: 2, 3: 25, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!