ID: 1132455046_1132455050

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1132455046 1132455050
Species Human (GRCh38) Human (GRCh38)
Location 16:17621-17643 16:17634-17656
Sequence CCAGGGGGCGCTGCTTGCTCTGG CTTGCTCTGGATCCTGTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 0, 3: 18, 4: 227} {0: 7, 1: 1, 2: 2, 3: 25, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!