ID: 1132461117_1132461124

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1132461117 1132461124
Species Human (GRCh38) Human (GRCh38)
Location 16:55343-55365 16:55389-55411
Sequence CCTTGCCCTTCGTAAAATGGAGC TTGTTCTTTGTTGTTGCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83} {0: 1, 1: 0, 2: 4, 3: 66, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!