ID: 1132497515_1132497530

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1132497515 1132497530
Species Human (GRCh38) Human (GRCh38)
Location 16:270861-270883 16:270898-270920
Sequence CCATCGAGAGTGGCAGCCAGGGC CAGGGAGCTGGTGGAAACCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 171} {0: 1, 1: 0, 2: 1, 3: 26, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!