ID: 1132502880_1132502883

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1132502880 1132502883
Species Human (GRCh38) Human (GRCh38)
Location 16:292427-292449 16:292448-292470
Sequence CCACACAGGCTTTCAGCTGGGAA AAGGGTCTGAACCCTGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 303} {0: 1, 1: 0, 2: 1, 3: 6, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!