ID: 1132509868_1132509875

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1132509868 1132509875
Species Human (GRCh38) Human (GRCh38)
Location 16:334165-334187 16:334208-334230
Sequence CCATGGCACACCAATAACAGCAC TAACACAGCACCCAGTACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114} {0: 7, 1: 8, 2: 4, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!