ID: 1132519457_1132519466

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1132519457 1132519466
Species Human (GRCh38) Human (GRCh38)
Location 16:380818-380840 16:380857-380879
Sequence CCGGGAAGTCGGGGAACAGCACC ACCTGGGCACCCGCGTGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 139} {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!