ID: 1132519982_1132520001

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1132519982 1132520001
Species Human (GRCh38) Human (GRCh38)
Location 16:382384-382406 16:382430-382452
Sequence CCCTGCCCTGCCCCGCCCGGCGC CAGCACGGGGACCCCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 23, 3: 449, 4: 1791} {0: 1, 1: 0, 2: 5, 3: 75, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!