ID: 1132547852_1132547863

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1132547852 1132547863
Species Human (GRCh38) Human (GRCh38)
Location 16:541402-541424 16:541437-541459
Sequence CCTGTCTGCGAGTTACCCTGATG CGGCAAAGGCAGGGCCGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 36} {0: 1, 1: 1, 2: 4, 3: 31, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!