ID: 1132556000_1132556006

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1132556000 1132556006
Species Human (GRCh38) Human (GRCh38)
Location 16:572946-572968 16:572976-572998
Sequence CCACTCTTCGTGCAGGCGAGATG CTGTGTCTGAGGAAGGCGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 51} {0: 1, 1: 0, 2: 1, 3: 25, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!