ID: 1132556554_1132556559

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1132556554 1132556559
Species Human (GRCh38) Human (GRCh38)
Location 16:575241-575263 16:575258-575280
Sequence CCTGCTTCTCTCCACAATCACAG TCACAGGTGCTGCTGGCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 292} {0: 1, 1: 0, 2: 1, 3: 26, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!