ID: 1132559957_1132559974

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1132559957 1132559974
Species Human (GRCh38) Human (GRCh38)
Location 16:589136-589158 16:589178-589200
Sequence CCGGCCGCGCTCCCCGCGTCCCG CCGGGCGGAAGGCTCACGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 403} {0: 1, 1: 0, 2: 0, 3: 2, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!