ID: 1132566995_1132567010

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1132566995 1132567010
Species Human (GRCh38) Human (GRCh38)
Location 16:628119-628141 16:628170-628192
Sequence CCAGAGGCCGGGGGAGCAGACAG GACCGGGGCCCTGGCTCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 383} {0: 1, 1: 0, 2: 3, 3: 17, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!