ID: 1132566999_1132567009

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1132566999 1132567009
Species Human (GRCh38) Human (GRCh38)
Location 16:628126-628148 16:628161-628183
Sequence CCGGGGGAGCAGACAGGGCCGGT AGCTTGGGTGACCGGGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 210} {0: 1, 1: 0, 2: 3, 3: 10, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!