ID: 1132567005_1132567017

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1132567005 1132567017
Species Human (GRCh38) Human (GRCh38)
Location 16:628153-628175 16:628179-628201
Sequence CCTCTGGAAGCTTGGGTGACCGG CCTGGCTCCCACGGGATGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101} {0: 1, 1: 0, 2: 4, 3: 23, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!