ID: 1132573981_1132573983

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1132573981 1132573983
Species Human (GRCh38) Human (GRCh38)
Location 16:656411-656433 16:656426-656448
Sequence CCACATGCTGGCTCGCTCCCACA CTCCCACACCGCCCCGGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 404} {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!