ID: 1132578683_1132578694

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1132578683 1132578694
Species Human (GRCh38) Human (GRCh38)
Location 16:675456-675478 16:675502-675524
Sequence CCGTGACTCCATTTACCAGCGGC CTGGAGCTGCGCCAGAGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 73} {0: 1, 1: 0, 2: 0, 3: 20, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!