ID: 1132579289_1132579302

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1132579289 1132579302
Species Human (GRCh38) Human (GRCh38)
Location 16:677754-677776 16:677787-677809
Sequence CCTCCCACCTGCCGCGTCCCTCT CCGAGGTGGGCCGGGCCGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 438} {0: 1, 1: 0, 2: 1, 3: 28, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!