ID: 1132600169_1132600175

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1132600169 1132600175
Species Human (GRCh38) Human (GRCh38)
Location 16:769611-769633 16:769627-769649
Sequence CCCCAGGGGGGCCCACAGGCTGC AGGCTGCCTGTAGATGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 280} {0: 1, 1: 0, 2: 0, 3: 11, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!